Thread Rating:
  • 1 Vote(s) - 5 Average
  • 1
  • 2
  • 3
  • 4
  • 5

Quotes about Artificial Intelligence

Reply
#22
Magical Realist Offline
“I believe that at the end of the century the use of words and general educated opinion will have altered so much that one will be able to speak of machines thinking without expecting to be contradicted.”
― Alan Turing, Computing machinery and intelligence

“Whether we are based on carbon or on silicon makes no fundamental difference; we should each be treated with appropriate respect.”
― Arthur C. Clarke, 2010: Odyssey Two

“Maybe the only significant difference between a really smart simulation and a human being was the noise they made when you punched them.”
― Terry Pratchett, The Long Earth

“Machinic desire can seem a little inhuman, as it rips up political cultures, deletes traditions, dissolves subjectivities, and hacks through security apparatuses, tracking a soulless tropism to zero control. This is because what appears to humanity as the history of capitalism is an invasion from the future by an artificial intelligent space that must assemble itself entirely from its enemy's resources.”
― Nick Land, Fanged Noumena: Collected Writings, 1987–2007

“Computers bootstrap their own offspring, grow so wise and incomprehensible that their communiqués assume the hallmarks of dementia: unfocused and irrelevant to the barely-intelligent creatures left behind. And when your surpassing creations find the answers you asked for, you can't understand their analysis and you can't verify their answers. You have to take their word on faith.”
― Peter Watts, Blindsight
Reply
#23
confused2 Offline
This me .. not quoting, sorry.
Do we need new powerful voices? If for every powerful voice a million go unheard .. knowing when to stop .. well .. just knowing when to stop.
Reply
#24
Magical Realist Offline
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

"At the most abstract level, the relation between urbanism and microelectronics is scalar (fractal). The coming computers are closer to miniature cities than to artificial brains, dominated by traffic problems (congestion), migration / communications, zoning issues (mixed use), the engineering potential of new materials, questions of dimensionality (3D solutions to density constraints), entropy or heat / waste dissipation (recycling / reversible computation), and disease control (new viruses)."----Implosion" (2011)

"...now it's computers and more computers and soon everybody will have one, 3-year-olds will have computers and everybody will know everything about everybody else long before they meet them and so they won't want to meet them. nobody will want to meet anybody else ever again and everybody will be a recluse like I am now." -The Continual Condition (Charles Bukowski)
Reply
#25
Magical Realist Offline
“I've found that human beings learn from their misdeeds just as often as from their good deeds. I am envious of that, for I am incapable of misdeeds. Were I not, then my growth would be exponential.”
― Neal Shusterman, Scythe

“If a machine ever gains awareness, it will be not due to our careful programming, but due to an unforeseeable anomaly.”
― Abhijit Naskar, The Gospel of Technology

“The Matrix, Agent Smith (an AI) articulates this sentiment: “Every mammal on this planet instinctively develops a natural equilibrium with the surrounding environment but you humans do not. You move to an area and you multiply and multiply until every natural resource is consumed and the only way you can survive is to spread to another area. There is another organism on this planet that follows the same pattern. Do you know what it is? A virus. Human beings are a disease, a cancer of this planet. You are a plague and we are the cure.”
― Max Tegmark, Life 3.0: Being Human in the Age of Artificial Intelligence

“the real risk with AGI isn’t malice but competence. A superintelligent AI will be extremely good at accomplishing its goals, and if those goals aren’t aligned with ours, we’re in trouble. As I mentioned in chapter 1, people don’t think twice about flooding anthills to build hydroelectric dams, so let’s not place humanity in the position of those ants.”
― Max Tegmark, Life 3.0: Being Human in the Age of Artificial Intelligence
Reply
Reply
#27
Magical Realist Offline
“All these inventions (and more) permit any literate person to cut and paste ideas, annotate them with her own thoughts, link them to related ideas, search through vast libraries of work, browse subjects quickly, resequence texts, refind material, remix ideas, quote experts, and sample bits of beloved artists. These tools, more than just reading, are the foundations of literacy.”
― Kevin Kelly, The Inevitable: Understanding the 12 Technological Forces That Will Shape Our Future

"The daily grinding of evolution, as accelerated by technology, churns out more and more complex organisms, with higher rates of energy use, and with increasing specialization. Minds are the ideal way to express complexity, energy density, increasing specialization, expanding diversity -- all in one system. Mindedness is what evolution produces. Mindedness is what technology wants, too". ---Kevin Kelly
Reply
Reply
#29
Magical Realist Offline
“The robot misconception is related to the myth that machines can’t control humans. Intelligence enables control: humans control tigers not because we’re stronger, but because we’re smarter. This means that if we cede our position as smartest on our planet, it’s possible that we might also cede control.”
― Max Tegmark, Life 3.0: Being Human in the Age of Artificial Intelligence
Reply
Reply


Possibly Related Threads…
Thread Author Replies Views Last Post
  Article Artificial intelligence: Four debates to expect in 2024 C C 0 52 Jan 3, 2024 02:01 AM
Last Post: C C
  Article A new approach to computation reimagines artificial intelligence C C 1 79 Apr 15, 2023 08:44 AM
Last Post: Kornee
  Article Artificial intelligence finds the first stars were not alone C C 0 57 Mar 27, 2023 07:14 PM
Last Post: C C
  The danger of advanced artificial intelligence controlling its own feedback C C 0 144 Oct 25, 2022 08:21 PM
Last Post: C C
  How artificial intelligence can explain its decisions C C 0 130 Sep 3, 2022 10:37 PM
Last Post: C C
  Will transformers take over artificial intelligence? C C 0 81 Mar 11, 2022 07:24 PM
Last Post: C C
  Consciousness in humans, animals and artificial intelligence C C 0 98 Dec 21, 2021 09:41 PM
Last Post: C C
  Artificial Intelligence that can discover hidden physical laws in various data C C 0 64 Dec 11, 2021 05:08 AM
Last Post: C C
  New report assesses progress and risks of artificial intelligence C C 0 73 Sep 17, 2021 01:58 AM
Last Post: C C
  Artificial Intelligence learns better when distracted C C 0 80 Jul 30, 2021 07:30 PM
Last Post: C C



Users browsing this thread: 1 Guest(s)